View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_78 (Length: 273)
Name: NF20954_low_78
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_78 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 51 - 262
Target Start/End: Complemental strand, 45364 - 45153
Alignment:
| Q |
51 |
atatttaacaattattctctgtaatatcgtggattatgtcgtgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttggatga |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45364 |
atatttaacaattattctctgtaatatcgtggattatgtcgtgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttggatga |
45265 |
T |
|
| Q |
151 |
tgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgattttcttg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264 |
tgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgattttcttg |
45165 |
T |
|
| Q |
251 |
gtacctttgcta |
262 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45164 |
gtacctttgcta |
45153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University