View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_80 (Length: 271)
Name: NF20954_low_80
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_80 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 29 - 254
Target Start/End: Complemental strand, 39072818 - 39072601
Alignment:
| Q |
29 |
atttttggatatgatcatttgaaatgaaacaacgctgcttataaataatagttaactcacacacatgtgtgaagaagaagagaggagataattaatgtga |
128 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
39072818 |
atttttggatatgatcatatgaaatgaaacaacgctacttataaataatagttaacgcacaca--tgtgtgaagaaga-----ggagataattaatgtga |
39072726 |
T |
 |
| Q |
129 |
aggagtagaaattaaggagattgtggttaaaaatatattaccaagcttgaaagnnnnnnnnnattgttgtattgtatatgaaacgttgaagaaggttttt |
228 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072725 |
aggagtagaaattaaggagattgaggttaaaaatatattacctagcttgaaag-ttttttttattgttgtattgtatatgaaacgttgaagaaggttttt |
39072627 |
T |
 |
| Q |
229 |
gatggttgaaaaggagggtagagggt |
254 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
39072626 |
gatggttgaaaaagagggtagagggt |
39072601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University