View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20954_low_85 (Length: 260)

Name: NF20954_low_85
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20954_low_85
NF20954_low_85
[»] chr3 (3 HSPs)
chr3 (112-191)||(26049295-26049374)
chr3 (1-46)||(26049442-26049486)
chr3 (64-95)||(26049392-26049423)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 112 - 191
Target Start/End: Complemental strand, 26049374 - 26049295
Alignment:
112 gcgtttgggcggagttttctgaacatctagatcattctaatggatgaaatcatgtgggtttgggtattgtttccatattt 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26049374 gcgtttgggcggagttttctgaacatctagatcattctaatggatgaaatcatgtgggtttgggtattgtttccatattt 26049295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 26049486 - 26049442
Alignment:
1 ataaaatatcttgaaaggattggacaagatttaactgacctccttt 46  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||    
26049486 ataaaatatcttgaa-ggattggacaagatttaactgacctccttt 26049442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 64 - 95
Target Start/End: Complemental strand, 26049423 - 26049392
Alignment:
64 gattagagagaccgatcaatccaacaaattcg 95  Q
    ||||||||||||||||||||||||||||||||    
26049423 gattagagagaccgatcaatccaacaaattcg 26049392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University