View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_85 (Length: 260)
Name: NF20954_low_85
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 112 - 191
Target Start/End: Complemental strand, 26049374 - 26049295
Alignment:
| Q |
112 |
gcgtttgggcggagttttctgaacatctagatcattctaatggatgaaatcatgtgggtttgggtattgtttccatattt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26049374 |
gcgtttgggcggagttttctgaacatctagatcattctaatggatgaaatcatgtgggtttgggtattgtttccatattt |
26049295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 26049486 - 26049442
Alignment:
| Q |
1 |
ataaaatatcttgaaaggattggacaagatttaactgacctccttt |
46 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26049486 |
ataaaatatcttgaa-ggattggacaagatttaactgacctccttt |
26049442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 64 - 95
Target Start/End: Complemental strand, 26049423 - 26049392
Alignment:
| Q |
64 |
gattagagagaccgatcaatccaacaaattcg |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26049423 |
gattagagagaccgatcaatccaacaaattcg |
26049392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University