View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_87 (Length: 256)
Name: NF20954_low_87
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_87 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 120 - 239
Target Start/End: Complemental strand, 43059194 - 43059078
Alignment:
| Q |
120 |
catgctttctcttttaatactacttcctagttcctccatcccacaatgagtgacataattaatttgactatttctattatttacattgcatagttttacc |
219 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43059194 |
catgctttctcttttaatactacttccgagttcctccatcccacaat--gtgaca----taatttgactatttctattatttacattgcatagttttacc |
43059101 |
T |
 |
| Q |
220 |
---attttcttctaatatataaa |
239 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43059100 |
ataattttcttctaatatataaa |
43059078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 91 - 125
Target Start/End: Complemental strand, 43059404 - 43059370
Alignment:
| Q |
91 |
cgataaccagtttgcattccttcttcatgcatgct |
125 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43059404 |
cgataaccagtttgcattccttcttcatgtatgct |
43059370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University