View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_88 (Length: 255)
Name: NF20954_low_88
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 32730207 - 32730432
Alignment:
| Q |
19 |
ggatgcaatgacgctttaatctctaatcttcatataattgctccaaaggatagtcccaacaccgatgggattgacatttcaacatcaaccaagatctccg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32730207 |
ggatgcaatgacgctttaatctctaatcttcatataattgctccaaaggatagtcccaacaccgatgggattgacatttcaacatcaaccaacatctccg |
32730306 |
T |
 |
| Q |
119 |
ttcagcattcaatcatttcaactggtttagttctagattatttctaatcatatatttatgttgatcacaaagtcaaaaattaattaatgtgatttatatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730307 |
ttcagcattcaatcatttcaactggtttagttctagattatttctaatcatatatttatgttgatcacaaagtcaaaaattaattaatgtgatttatatt |
32730406 |
T |
 |
| Q |
219 |
tttaaaatttctgatttattgttcat |
244 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
32730407 |
tttaaaatttcttatttattgttcat |
32730432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 38090094 - 38090182
Alignment:
| Q |
22 |
tgcaatgacgctttaatctctaatcttcatataattgctccaaaggatagtcccaacaccgatgggattgacatttcaacatcaaccaa |
110 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| || || ||||||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
38090094 |
tgcaatggcgctttaatctcccatcttcatataattgcaccggagaatagtcccaacaccgatggaattgatatttcaagatcaaccaa |
38090182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University