View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_93 (Length: 249)
Name: NF20954_low_93
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_93 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 135 - 245
Target Start/End: Complemental strand, 2134041 - 2133931
Alignment:
| Q |
135 |
aagttaactacttgacttacattagacatatagttagatgatagatatgcattaagtattcaaatattctagaattacttttaacatgtttgaggttgta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2134041 |
aagttaactacttgacttacattagacatatagttagatgatagatatgcattaagtattcaaatattctagaattacttttaacatgtttgaggttgta |
2133942 |
T |
|
| Q |
235 |
cattttacttc |
245 |
Q |
| |
|
||||||||||| |
|
|
| T |
2133941 |
cattttacttc |
2133931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 8 - 107
Target Start/End: Complemental strand, 2134141 - 2134042
Alignment:
| Q |
8 |
gattattctcatttctgacctcttttttgacatatttagtttctttcttgcctttacagtagtcttccaaattttcaactcgttttactattagggacaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2134141 |
gattattctcatttctgacctcttttttgacatatttagtttctttcttgcctttacagtagtcttccaaattttcaactcgttttactattagggacaa |
2134042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University