View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20954_low_93 (Length: 249)

Name: NF20954_low_93
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20954_low_93
NF20954_low_93
[»] chr4 (2 HSPs)
chr4 (135-245)||(2133931-2134041)
chr4 (8-107)||(2134042-2134141)


Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 135 - 245
Target Start/End: Complemental strand, 2134041 - 2133931
Alignment:
135 aagttaactacttgacttacattagacatatagttagatgatagatatgcattaagtattcaaatattctagaattacttttaacatgtttgaggttgta 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2134041 aagttaactacttgacttacattagacatatagttagatgatagatatgcattaagtattcaaatattctagaattacttttaacatgtttgaggttgta 2133942  T
235 cattttacttc 245  Q
    |||||||||||    
2133941 cattttacttc 2133931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 8 - 107
Target Start/End: Complemental strand, 2134141 - 2134042
Alignment:
8 gattattctcatttctgacctcttttttgacatatttagtttctttcttgcctttacagtagtcttccaaattttcaactcgttttactattagggacaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2134141 gattattctcatttctgacctcttttttgacatatttagtttctttcttgcctttacagtagtcttccaaattttcaactcgttttactattagggacaa 2134042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University