View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_97 (Length: 246)
Name: NF20954_low_97
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_97 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 51189225 - 51189402
Alignment:
| Q |
1 |
ttttgataagataccggtattagtaggacaaataaat--tcttataaattttgaatttaatacatattatttaggtaggttttctttggttggagacttt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51189225 |
ttttgataagataccggtattagtaggacaaataaatattcttataaattttgaatttaatacatattatttaggtaggttttctttggttggagacttt |
51189324 |
T |
 |
| Q |
99 |
gtttgatttaannnnnnnnagaggaaaagaaaatggcgcaaaattattccaaagtcaattttagctctcctttaattt |
176 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51189325 |
atttgatttaattttttttagaggaaaagaaaagggcgcaaaattattccaaagtcaattttaggtctcctttaattt |
51189402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 180 - 217
Target Start/End: Original strand, 51189432 - 51189469
Alignment:
| Q |
180 |
tagagggatgtacaaaattcatcctttccgtgaatatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51189432 |
tagagggatgtacaaaattcatcctttccgtgaatatg |
51189469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University