View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20955_high_5 (Length: 219)
Name: NF20955_high_5
Description: NF20955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20955_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 202
Target Start/End: Original strand, 46582401 - 46582595
Alignment:
| Q |
8 |
agaagcataggtcatggccaatatgatatagaaagctgggcagagaaaaaatgttctacttgtattgatggcagaattaaccattcaatacctatgaggg |
107 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46582401 |
agaatcatgggtcatggccaatatgatatagaaagctgggcagagaaaaaatgttctacttgtattgatggcagaattaaccattcaatacctatgagag |
46582500 |
T |
|
| Q |
108 |
taaatgaaactagcaccacttcacttcctgcaacacctatcaatactcagcaagaaactagacaagaagaacaatcttctcagaactctccacct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582501 |
taaatgaaactagcaccacttcacttcctgcaacacctatcaatactcagcaagaaactagacaagaagaacaatcttctcagaactctccacct |
46582595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University