View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20956_high_9 (Length: 297)
Name: NF20956_high_9
Description: NF20956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20956_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 1252119 - 1251834
Alignment:
| Q |
1 |
ctgggatgaaccaaccgccaagtaagctttggaaattctgttatcgagtactatttgagacctgattcttgagttaacatgtaacaattgagctaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1252119 |
ctgggatgaaccaaccgccaagtaagctttggaaattctgttatcgagtactatttcagacctgattcttgagttaacatgtaacaattgagctaatttt |
1252020 |
T |
|
| Q |
101 |
--------------------tgtttcgtagatacgtagaaaattgcaagtttccacaagaaggttcagcaccaaagtctcttaggtatattggcaggtat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1252019 |
caaatgaatccttggaactttgtttcgtagatacgtagaaaattgcaagtttccacaagaaggttcagcaccaaagtctcttaggtatattggcaggtat |
1251920 |
T |
|
| Q |
181 |
atgattctgatctttatgtagttttatcttgtttttccttcaagtttcttcannnnnnnngctaacgaaaaatgcataatgcagta |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1251919 |
atgattctgatctttatgtagttttatcttgtttttccttcaagtttcttcattttatttgctaacgaaaaatgcataatgcagta |
1251834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 297
Target Start/End: Original strand, 1252498 - 1252536
Alignment:
| Q |
259 |
atgcagtaaccagccgctaccaaactgctcccaggttgc |
297 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1252498 |
atgcagtaaccagctgctaccaaactgctcccaggttgc |
1252536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University