View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20956_low_10 (Length: 266)
Name: NF20956_low_10
Description: NF20956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20956_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 89 - 248
Target Start/End: Complemental strand, 53279272 - 53279113
Alignment:
| Q |
89 |
gaaatcggtaagtcatacatgtaattaagttgtttatataaaactaaccaaaaggaaactagaagaactggtgtatatattttcgaagaagaggatttaa |
188 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53279272 |
gaaatcggtaagtcctacatgtaattaagttgtttatataaaactaaccaaaaggaaactagaagaactggtgtatatattttcgaagaagaggatttaa |
53279173 |
T |
 |
| Q |
189 |
gagcttgctgtaaacactctccgagggatgaaaactgtcccagaaaacgtagtccctaac |
248 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53279172 |
gagcttgctgtaaacactctctgagggatgaaaactgtcccagaaaacgtagtccctaac |
53279113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 88
Target Start/End: Complemental strand, 53279380 - 53279312
Alignment:
| Q |
20 |
atcgatgtagatgatgtccccttaaaacacaaaataatttatttaatgtacctcatcaaccatacactt |
88 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53279380 |
atcgatgtagatgatatccccttaaaacacaaaataatttatttaatgtacctcatcaaccatacactt |
53279312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University