View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20956_low_13 (Length: 239)
Name: NF20956_low_13
Description: NF20956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20956_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 67 - 187
Target Start/End: Complemental strand, 19602458 - 19602337
Alignment:
| Q |
67 |
tcaacttctaatttcattatttacttttgtttt-atatatgctttccattggaggcggggtatacgttacaaaggacatatgaaaagcagaatgaatgca |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19602458 |
tcaacttctaatttcattatttacttttgtttttatatatgccttccattggaggcggggtatacgttacaaaggacatatgaaaagcagaatgaatgca |
19602359 |
T |
 |
| Q |
166 |
tctttggtatcaatacggtttt |
187 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
19602358 |
tctttggtatcaatactgtttt |
19602337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 19602499 - 19602458
Alignment:
| Q |
1 |
ttaattctttttggatagaacgcccgtttaagaattactcct |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19602499 |
ttaattctttttggatagaacgcccgtttaaaaattactcct |
19602458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University