View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20956_low_14 (Length: 238)
Name: NF20956_low_14
Description: NF20956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20956_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 23027474 - 23027342
Alignment:
| Q |
1 |
tctctcccatacgacctgtaggagtttgagagactataccagctatagctttatacccttcagagtcataatcctgtaagaaacagtataaacatattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23027474 |
tctctcccatacgacctgtaggagtttgagagactataccagctatagctttatacccttcagagtcataatcctgtaagaaacagtataaacatattta |
23027375 |
T |
|
| Q |
101 |
tacttatcaacaactctcaactttaaatatgcc |
133 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| |
|
|
| T |
23027374 |
tacttatcagcaactctcaattttaaatatgcc |
23027342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University