View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20959_high_2 (Length: 355)
Name: NF20959_high_2
Description: NF20959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20959_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 17 - 339
Target Start/End: Complemental strand, 12571556 - 12571234
Alignment:
| Q |
17 |
aatatcatcaatcaaactatggaatatagctgcctcaatctccataaccaactcatcttgctcctcaacaaacctactccatccacctctcctatccatc |
116 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12571556 |
aatatcatcaatcaaactttgtaatatagctgcctcaatctccataaccaactcatcttgctcctcatcaaacctactccatccacctctcctatccatc |
12571457 |
T |
 |
| Q |
117 |
tccttgatataagcatctttattaacatgcacaatatcataagctttttcaaatgactcatttatccaatcctcagcaattttcattatctccaactcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12571456 |
tccttgatataagcatctttattaacatgcacaatatcataagctttttcaaatgactcatttatccaatcctcagcaattttcattatctccaactcaa |
12571357 |
T |
 |
| Q |
217 |
gcccctcattattcctcttttggtttctattaccacttagttcttccttgaaaaattccagcagaactatatctaaattgtcgtcgcaactttgcaccga |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12571356 |
gcccctcattattcctcttttggtttctattaccacttagttcttccttgaaaaattccagcagaactatatctaaattgtcgtcgcaattttgcaccga |
12571257 |
T |
 |
| Q |
317 |
tgaacttgttgctttgacaatat |
339 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12571256 |
tgaacttgttgctttgacaatat |
12571234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University