View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20959_low_11 (Length: 213)
Name: NF20959_low_11
Description: NF20959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20959_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 67 - 194
Target Start/End: Complemental strand, 33327003 - 33326876
Alignment:
| Q |
67 |
cttatctactacctctcagaacacccatcaatcatctcattccgttggagccacagtcactcatggggttcaacatggtctttcctcatcacctccatag |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33327003 |
cttatctactacctctcagaacacccatcaatcatctcattccgttggagccacagtcactcatggggttcaacatggtctttcctcatcacctccatag |
33326904 |
T |
 |
| Q |
167 |
ccacctacctcatcctctctctcttcct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33326903 |
ccacctacctcatcctctctctcttcct |
33326876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University