View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20959_low_8 (Length: 249)
Name: NF20959_low_8
Description: NF20959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20959_low_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 42 - 249
Target Start/End: Complemental strand, 54731586 - 54731384
Alignment:
| Q |
42 |
acataatacaactagttgtattgtattaacctggcagtagcttattggagtgcatgacagttggtcaatatagaaaccacaaagatttgcaacccattcc |
141 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54731586 |
acataatacaactagttg-----tattaacctggcagtagcttattggagtgcatgacagttggtcaatatagaaaccacaaagatttgcaacccattcc |
54731492 |
T |
|
| Q |
142 |
ttactctataagaaaaatatgccacccactctctttgcttaattgctttctccttcatctcttttttgtcaaccctccaaagccttcatggtccctcagt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54731491 |
ttactctataagaaaaatatgccacccactctctttgcttaattgctttctccttcatctcttttttgtcaaccctccaaagccttcatggtccctcagt |
54731392 |
T |
|
| Q |
242 |
aacttttt |
249 |
Q |
| |
|
|||||||| |
|
|
| T |
54731391 |
aacttttt |
54731384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 42 - 249
Target Start/End: Complemental strand, 5305666 - 5305464
Alignment:
| Q |
42 |
acataatacaactagttgtattgtattaacctggcagtagcttattggagtgcatgacagttggtcaatatagaaaccacaaagatttgcaacccattcc |
141 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5305666 |
acataatacaactagttg-----tattaacctggcagtagcttattggagtccatgacagttggtcaatatagaaaccacaaagatttgcaacccattcc |
5305572 |
T |
|
| Q |
142 |
ttactctataagaaaaatatgccacccactctctttgcttaattgctttctccttcatctcttttttgtcaaccctccaaagccttcatggtccctcagt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5305571 |
ttactctataagaaaaatatgccacccactctctttgcttaattgctttctccttcatctcttttttgtcaaccctccaaagccttcatggtccctcagt |
5305472 |
T |
|
| Q |
242 |
aacttttt |
249 |
Q |
| |
|
|||||||| |
|
|
| T |
5305471 |
aacttttt |
5305464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University