View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2095_high_11 (Length: 227)
Name: NF2095_high_11
Description: NF2095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2095_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 36945842 - 36945987
Alignment:
| Q |
1 |
aaataaccgatggtattattgatcccctctnnnnnnntaatggcattgagatatatataatttcaactagaatacttgaagagaaaggaaagagaatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36945842 |
aaataaccgatggtattattgatcccctctaaaaaaataatggcattgagatatatataatttcaactagaatacttgaagagaaaggaaagagaatata |
36945941 |
T |
 |
| Q |
101 |
tgattcc-nnnnnnnntatgattttgcttattaaaataatcaatgg |
145 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36945942 |
tgattccaaaaaaatatatgattttgcttattaaaataatcaatgg |
36945987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 59 - 107
Target Start/End: Original strand, 36945779 - 36945827
Alignment:
| Q |
59 |
aatttcaactagaatacttgaagagaaaggaaagagaatatatgattcc |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
36945779 |
aatttcaactagaataattgaagagaaaggaaaggaaatatatgattcc |
36945827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University