View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2095_low_11 (Length: 228)
Name: NF2095_low_11
Description: NF2095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2095_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 10 - 146
Target Start/End: Original strand, 34765793 - 34765924
Alignment:
| Q |
10 |
aagaatataccatacagaaccttcaattttcgaacctgataaggaattgtacttgatatatgctatataagctagctaactcgtttgacattcaaaagtt |
109 |
Q |
| |
|
||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34765793 |
aagaaaataccatgcagaaccttcaattttcaaacctgataaggaattgtacttgatatatgctatataagctagctaactcgtttgacattcaaaagtt |
34765892 |
T |
 |
| Q |
110 |
agtgcatcaaaagttactgcaactcccaactcaaaca |
146 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
34765893 |
agtgcatca-----tactgcaactcccaactcaaaca |
34765924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 143 - 212
Target Start/End: Original strand, 34765966 - 34766035
Alignment:
| Q |
143 |
aacatgcattttcttgtgaaagataaatcatacgtattcaaacttttcatttaattttatcatatcatat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34765966 |
aacatgcattttcttgtgaaagataaatcatacgtattcaaacttttcatttaattttatcatatcatat |
34766035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University