View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2095_low_12 (Length: 227)

Name: NF2095_low_12
Description: NF2095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2095_low_12
NF2095_low_12
[»] chr8 (2 HSPs)
chr8 (1-145)||(36945842-36945987)
chr8 (59-107)||(36945779-36945827)


Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 36945842 - 36945987
Alignment:
1 aaataaccgatggtattattgatcccctctnnnnnnntaatggcattgagatatatataatttcaactagaatacttgaagagaaaggaaagagaatata 100  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36945842 aaataaccgatggtattattgatcccctctaaaaaaataatggcattgagatatatataatttcaactagaatacttgaagagaaaggaaagagaatata 36945941  T
101 tgattcc-nnnnnnnntatgattttgcttattaaaataatcaatgg 145  Q
    |||||||         ||||||||||||||||||||||||||||||    
36945942 tgattccaaaaaaatatatgattttgcttattaaaataatcaatgg 36945987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 59 - 107
Target Start/End: Original strand, 36945779 - 36945827
Alignment:
59 aatttcaactagaatacttgaagagaaaggaaagagaatatatgattcc 107  Q
    |||||||||||||||| |||||||||||||||||  |||||||||||||    
36945779 aatttcaactagaataattgaagagaaaggaaaggaaatatatgattcc 36945827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University