View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2095_low_7 (Length: 284)
Name: NF2095_low_7
Description: NF2095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2095_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 271
Target Start/End: Complemental strand, 52712058 - 52711805
Alignment:
| Q |
19 |
tcttcctcaatttcaaactctctttctctgcgactatcactcatgttctctatcaaacctgcatttcaaatttcctatacttgtgttacaaaattattca |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52712058 |
tcttcctcaatttcaaagtctctttctcttcgactatcactcatgttctccatcaaacctgcatttcaaatttcctatacttgtgttacaaaattattca |
52711959 |
T |
|
| Q |
119 |
acaaaacatattaggtcc-actaccatttccaccaccaatgctatctttcttttttgtgccaacacttgtagaacaaaaaagcattggatttggaagagg |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52711958 |
acaaaacatattaggtcccactaccatttccaccaccaatgctatctttcttttttgtgcccacacttgtagaacaaaaaagcattggatttggaagagg |
52711859 |
T |
|
| Q |
218 |
ttaagaaccaccattattattaaacaactcaccaccgatactccgccctctcct |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52711858 |
gtaagaaccaccattattattaaacaactcaccaccgatactccgccctctcct |
52711805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 127 - 273
Target Start/End: Complemental strand, 52717260 - 52717117
Alignment:
| Q |
127 |
tattaggtccactaccatttccaccaccaatgctatctttcttttttgtgccaacacttgtagaacaaaaaagcattggatttggaagaggttaagaacc |
226 |
Q |
| |
|
||||||||||| ||||| ||||||| || |||||||||||||| ||||||||| |||||||||||| | ||||||| ||||||||| |||| |||||||| |
|
|
| T |
52717260 |
tattaggtccattaccacttccaccgcccatgctatctttcttctttgtgccagcacttgtagaaccagaaagcataggatttggaggagggtaagaacc |
52717161 |
T |
|
| Q |
227 |
accattattattaaacaactcaccaccgatactccgccctctccttt |
273 |
Q |
| |
|
||||| |||| ||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
52717160 |
accat---tattgaacaactcaccactcatactcctccctccccttt |
52717117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University