View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20960_high_2 (Length: 413)
Name: NF20960_high_2
Description: NF20960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20960_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 16 - 293
Target Start/End: Original strand, 2085022 - 2085300
Alignment:
| Q |
16 |
atgtatttggtaggtaaccgtttgccgccatcttgtgttgccgaccgagcatgcccaccccacaaacttgtcttcatgtattcatatttgctcccacaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2085022 |
atgtatttggtaggtaaccgtttgccgccatcttgtgttgccgaccgagcatgcccaccccacaaacttgtcttcaagtattcatatttgctcccacaaa |
2085121 |
T |
 |
| Q |
116 |
aagtaagtactaggaatgagacaagccattttttccctttcaaaaagagaaaaaattgactaatcaatccgaagattcaaactaaatcaatttattcggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2085122 |
aagtaagtactaggaatgagacaagcaatttttttcttttcaaaaagagaaaaaattgactaatcaatccgaagattcaaactaaatcaatttattcggt |
2085221 |
T |
 |
| Q |
216 |
ttaccttattttggtgtaaaccaaatgaatcatatccggcccttattagtttcgat-gcgatttgatattatttaaaat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2085222 |
ttaccttattttggtgtaaaccaaatgaatcatatccgacccttattagtttggatatcgatttgatattatttaaaat |
2085300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 291 - 383
Target Start/End: Original strand, 2085374 - 2085467
Alignment:
| Q |
291 |
aatagtagcatttatttctttaatcataacatataatctctttcatcgtaacatatgtatttatttta-ttttaatatgataaaaagtttacaa |
383 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2085374 |
aatagtagcatttatttctttaataatagcatataatctctttcatcgtaacatatgtatttattttatttttaatatgataaaaagtttacaa |
2085467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University