View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20960_low_4 (Length: 293)
Name: NF20960_low_4
Description: NF20960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20960_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 15 - 269
Target Start/End: Complemental strand, 43657894 - 43657640
Alignment:
| Q |
15 |
cagagaaccggtactttcctttgagaaaattggcatggatattatgccattgattgcgagatatatgaagtgcatgtattatgttaacatcactgtatga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43657894 |
cagagaaccggtactttcctttgagaaaatcggcatggatattatgccattgattgcgagatatatgaagtgcatgtattatgttaacatcactgtatga |
43657795 |
T |
|
| Q |
115 |
gcaggcaggattgtgaatgaaattacaagcaggtaccaaagacaaaaaaccatagattttgatatctatattcttttttcttttgaaggactttagcaat |
214 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43657794 |
gcaggcaggattgtgagtgcaattacaagcaggtaccaaagacaaaaaaccatagattttgatatctatattcttttttcttttgaaggactttagcaat |
43657695 |
T |
|
| Q |
215 |
ggtaattaaggaactccattttttgtacacaagcctagcattatcgagactttcg |
269 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43657694 |
ggtaatcaaggaactccattttttgcacacaagcctagcattatcgagactttcg |
43657640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 256
Target Start/End: Complemental strand, 10371120 - 10371080
Alignment:
| Q |
216 |
gtaattaaggaactccattttttgtacacaagcctagcatt |
256 |
Q |
| |
|
||||||||||||||||||| |||| |||| ||||||||||| |
|
|
| T |
10371120 |
gtaattaaggaactccattatttgaacacgagcctagcatt |
10371080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University