View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20960_low_9 (Length: 211)
Name: NF20960_low_9
Description: NF20960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20960_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 52860358 - 52860244
Alignment:
| Q |
1 |
atttcggaatgagatgagttgatttgtgttgctgctgctgc---atgtgttaaggttaatgcaatgaaggtgagaaatatagccgttgttgccatttgtg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860358 |
atttcggaatgagatgagttgatttgtgttgctgcagctgctgaatgtgttaaggttaatgcaatgaaggtgagaaatatagccgttgttgccatttgtg |
52860259 |
T |
|
| Q |
98 |
tgttgtgagttgaat |
112 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52860258 |
tgttgtgagttgaat |
52860244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University