View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20962_high_22 (Length: 238)
Name: NF20962_high_22
Description: NF20962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20962_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 44107901 - 44108103
Alignment:
| Q |
20 |
catcaaacatacacatagcttttgcaaaaccatggtggctcggtgcgatttccgcaaacacaatgtgatatcaaacatgcattgatataagacagaatta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44107901 |
catcaaacatacacatagcttttgcaaaaccatggtggctcggtgcaatttccgcaaacacaatgtgatatcaaacatgcattgatataagacacaatta |
44108000 |
T |
 |
| Q |
120 |
aggagcattggtgtcttttgtgtttttgagtttgcttgcattgttgttgattgtggttattaactcattaaactggtttatatattatctattaagatct |
219 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
44108001 |
aggagcatcggtgtcttttgtgtttttgagtttgcttgcattgttgttgattgtggttattaactcattaaactggtttatatgtcatctattaagatct |
44108100 |
T |
 |
| Q |
220 |
ctg |
222 |
Q |
| |
|
||| |
|
|
| T |
44108101 |
ctg |
44108103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 194
Target Start/End: Original strand, 44112243 - 44112295
Alignment:
| Q |
142 |
tttttgagtttgcttgcattgttgttgattgtggttattaactcattaaactg |
194 |
Q |
| |
|
|||||| ||||| ||||||||||||||| || ||||||||| ||||||||||| |
|
|
| T |
44112243 |
tttttgggtttgtttgcattgttgttgaatgaggttattaattcattaaactg |
44112295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University