View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20962_high_25 (Length: 202)
Name: NF20962_high_25
Description: NF20962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20962_high_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 44 - 188
Target Start/End: Original strand, 11928529 - 11928673
Alignment:
| Q |
44 |
tttaacaaatcttgtcttgagaggacaatttcttcgttttggctcgttgcctcacttcttgcaaacaatcaggaaaattattccaaacttaagagagttg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
11928529 |
tttaacaaatcttgtcttgagaggacaatttcttcgttttggctcgttgcctcacttcctgcaaacaatcagtaaaattactccaaacttatgagagttg |
11928628 |
T |
|
| Q |
144 |
aggttaattgattttggtcttatagataatgatgtcgcgcctttg |
188 |
Q |
| |
|
|| || || | ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
11928629 |
agattggttcaatttggtcttctagataatgatgtcgcgtctttg |
11928673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 104 - 180
Target Start/End: Complemental strand, 11852666 - 11852590
Alignment:
| Q |
104 |
gcaaacaatcaggaaaattattccaaacttaagagagttgaggttaattgattttggtcttatagataatgatgtcg |
180 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
11852666 |
gcaaacaatcatgaagtttattccaaacttaagagagttgaggttagttgattttggtcttatagatactgatgtcg |
11852590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 105 - 180
Target Start/End: Complemental strand, 11833401 - 11833326
Alignment:
| Q |
105 |
caaacaatcaggaaaattattccaaacttaagagagttgaggttaattgattttggtcttatagataatgatgtcg |
180 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
11833401 |
caaacaatcatgaagtttattccaaacttaagagagttgaggttagttgattttggtcttatagatactgatgtcg |
11833326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 101 - 188
Target Start/End: Original strand, 11962876 - 11962963
Alignment:
| Q |
101 |
cttgcaaacaatcaggaaaattattccaaacttaagagagttgaggttaattgattttggtcttatagataatgatgtcgcgcctttg |
188 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
11962876 |
cttgcaaacaatcatgaagttttttccaaacttaagagagttgaggttagttgaatttggtctgatagataatgatgtcgcgtctttg |
11962963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University