View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20962_low_12 (Length: 387)
Name: NF20962_low_12
Description: NF20962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20962_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 42331910 - 42331698
Alignment:
| Q |
17 |
aaaatagagtggaattgctgtttgttttgtatgaataggatgttttactctccattcgaagtggaatctgtgggttacgtcgctcaatggagactcagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331910 |
aaaatagagtggaattgctgtttgttttgtatgaataggatgttttactctccattcgaagtggaatctgtgggttacgtcgctcaatggagactcagtt |
42331811 |
T |
 |
| Q |
117 |
ttaagagcatgaatatgattcctcacagctttatccacacgtccgaagctttcaagatatctaaatggaattggtaactt--ttttcctttctctcttct |
214 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
42331810 |
ttaagagcatgaatatgattccccacagctttatccacacgtccgaagctttcaagatctctaaatggaattggtaactttttttttctttctctcttct |
42331711 |
T |
 |
| Q |
215 |
agttcgacaatac |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42331710 |
agttcgacaatac |
42331698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 330 - 372
Target Start/End: Complemental strand, 42331596 - 42331554
Alignment:
| Q |
330 |
acttcccaacacgaaggcacatatcattctcgagggattccct |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331596 |
acttcccaacacgaaggcacatatcattctcgagggattccct |
42331554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University