View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20962_low_22 (Length: 261)
Name: NF20962_low_22
Description: NF20962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20962_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 42306361 - 42306121
Alignment:
| Q |
1 |
gggattagcggcgtgtcatgagaaacgaggcgaaataggtaaagcactaatctcttttcactcttcctttgaattcatattcttttgattcattaacatg |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42306361 |
gggattagcggcgtgtgatgagaaacgaggcgaaataggtaaagcactaatctcttttcactcttcctttgaattcatattcttttgattcattaacgtg |
42306262 |
T |
|
| Q |
101 |
tttttcattgaatttttgttgttataggaattgcctttgaagtcaatatcatcttgtttggaattcaagtgtcgaacttgtagattcatcaacaaattct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42306261 |
tttttcattgaatttttgttgttataggaattgcctttgaagtcaatatcatcttgtttggaattcaagtgtcgaacttgtagattcatcaacaaattct |
42306162 |
T |
|
| Q |
201 |
aaggctcttacgtttactgcttctgcgggacatgtgtatgt |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42306161 |
aaggctcttacgtttactgcttctgctggacatgtgtatgt |
42306121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University