View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20962_low_24 (Length: 243)
Name: NF20962_low_24
Description: NF20962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20962_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 31801600 - 31801386
Alignment:
| Q |
19 |
aagagcatccatcaatcatggtgacacatcacaaccaacattttcctaacaaatttgggaatatacccaataattttgtaccctcgtgcaaaacaaaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801600 |
aagagcatccatcaatcatggtgacacatcacaaccaacattttcctaacaaatttgggaatatacccaataattttgtaccctcgtgcaaaacaaaatc |
31801501 |
T |
|
| Q |
119 |
aggtccaccgatcaaattagggaagccaaacaacgttgttctttaatttggatgcatgaatcgaactcagacagttatattagttctggcttctcttaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801500 |
aggtccaccgatcaaattagggaagccaaacaacgttgttctttaatttggatgcatgaatcgaactcagacagttatattagttctggcttctcttaaa |
31801401 |
T |
|
| Q |
219 |
gatgtctctcttctt |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31801400 |
gatgtctctcttctt |
31801386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University