View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20962_low_27 (Length: 216)
Name: NF20962_low_27
Description: NF20962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20962_low_27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 52860753 - 52860556
Alignment:
| Q |
19 |
tatttggtattgtaccagagagaaagttacgagcaaggttgagaatttgaaggttggtgagggtgagaagtgaagaagggagataaccagagagagagtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52860753 |
tatttggtattgtaccagagagaaagttacgagcaaggttgagaatttgaagattggtgagggtgagaagtgaaggagggagataaccagagagagagtt |
52860654 |
T |
 |
| Q |
119 |
gttgtgaagataaacagcacgtaggaagagacaatgagaaagagaagaaggtattgatgagttaaggttgttggcatggagactaagtttacgaagct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52860653 |
gttgtgaagataaacagcacgtaggaagagacaatgagaaagagaagaaggtattgatgagttaaggttgttggaatggagactaagtttacgaagct |
52860556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University