View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_high_27 (Length: 362)
Name: NF20963_high_27
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 73 - 353
Target Start/End: Complemental strand, 18806219 - 18805939
Alignment:
| Q |
73 |
atgagtaacccttgggaaggtgaggagttttcggcccataaggacgtgggtaagccccgaacccttggtgagggcatgtctatcgcatggtgtcgtctgc |
172 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18806219 |
atgagtaacccttgggaaggtgaggatttttcggcccataaggacgtgggtaagccccgaacccttggtgagggcatgtctatcgtatggtgtcgtctgc |
18806120 |
T |
|
| Q |
173 |
ttagtgaactcaggtcggtcccgagcctagtcaaattggaccttgggtcagactgaaacattttttatttattaaaaagtaatatgtattgaattttgga |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18806119 |
ttagtgaactcaggtcggtcccgagcctagtcagattgggccttgggtcagtctgaaacattttttatttattaaaaagtaatatgtattgaattttgga |
18806020 |
T |
|
| Q |
273 |
tcattattcgatctcgatccaacaaccattgatgttgtaacatggatgacgtgatcgcatctctactgaaaattgttgatg |
353 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
18806019 |
tcattattcgatctcgatccaacaaccatggacgttgtaacatggatgatgtgatcgtatctctactgaaaattgttgatg |
18805939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 18806343 - 18806394
Alignment:
| Q |
19 |
ttctctcttgaacctctccggtggaaaaggaccctcaatgaacaactcaaca |
70 |
Q |
| |
|
|||||||||||||| | | |||||| |||| ||||||||||||||||||||| |
|
|
| T |
18806343 |
ttctctcttgaaccccactggtggagaaggtccctcaatgaacaactcaaca |
18806394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University