View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_high_37 (Length: 325)
Name: NF20963_high_37
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 21 - 293
Target Start/End: Original strand, 40518635 - 40518906
Alignment:
| Q |
21 |
gttagttgtgattcttctgttgatgatttggatcatgtgnnnnnnnactt-gtccttttgcaatgcaaggttggtttacaattggtttatagaacaacat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518635 |
gttagttgtgattcttctgttgatgatttggatcatgtgtttttttacttagttcttttgcaatgcaaggttggtttacaattggtttatagaacaacat |
40518734 |
T |
 |
| Q |
120 |
tcaacatattgtcaacaaaaccggtacgacctcataagtaatctttttgtagtcataacatctcacggccagactttgcaactcataccgttagtttgtt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||| | ||| |||||| ||| |||||||||||||||| |||||||||| | |
|
|
| T |
40518735 |
tcaacatattgtcaacaaaaccggtacgacctcataattaatttttttgtagttagaacgtctcac-gccggactttgcaactcatatcgttagtttg-t |
40518832 |
T |
 |
| Q |
220 |
ttagattttatggaaggaccgcaatctcaaaatgtgggatgatgttacatagacggttgctcaaatagttgaca |
293 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518833 |
ttggattttatggaaggaccgcaatctcaaagtgtgggatgatgttacatagacggttgctcaaatagttgaca |
40518906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 209 - 291
Target Start/End: Original strand, 25983955 - 25984037
Alignment:
| Q |
209 |
gttagtttgttttagattttatggaaggaccgcaatctcaaaatgtgggatgatgttacatagacggttgctcaaatagttga |
291 |
Q |
| |
|
||||| ||||||| || |||||||||| ||| ||| |||||| |||| |||||||||||| |||| ||||||| ||||||| |
|
|
| T |
25983955 |
gttagcttgttttggagtttatggaagtaccacaacctcaaagtgtgagatgatgttacagagacaactgctcaagtagttga |
25984037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University