View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_high_39 (Length: 308)
Name: NF20963_high_39
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_high_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 130 - 297
Target Start/End: Original strand, 2225400 - 2225566
Alignment:
| Q |
130 |
ggcggcttctaaggcgaggactctattatgttcctcaccgttggaccaattttattcaccctttgatttatccaaaggtttagatgagttagaaattaat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2225400 |
ggcggcttctaaggcgaggactctattatgtccctcaccgttggaccaattttatccaccctttgatttatccaaaggtttagatgagttagaaattaat |
2225499 |
T |
 |
| Q |
230 |
acgataacacatgtatatttatatacctaatcagttacctcaaccttctccctccctctatcatctct |
297 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2225500 |
acgataacacatgtata-atatatacctaatcagttacctcaaccttctccctccctctatcatctct |
2225566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University