View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_high_41 (Length: 294)
Name: NF20963_high_41
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 13 - 275
Target Start/End: Complemental strand, 53754773 - 53754510
Alignment:
| Q |
13 |
aatatatataattctccattaaatgacatataattgtaccccaaaaatgaccatat-agttaaagcttttattttatggcacatttagtggtagattttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53754773 |
aatatatataattctccattaaatgacatataattgtaccccaaaaatgaccatattagttaaagcttttattatatggcacatttagtggtagattttt |
53754674 |
T |
 |
| Q |
112 |
aaatactattacatgaattgagtggtagactgtagatatggcaatgtgacaatccatataaggaatgtggatttaattgaatgaaattgcaggaatggga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53754673 |
aaatactattacatgaattgagtggtagactgtagatatggcaatgtgacaatccatttaaggaatgtggatttaattgaatgaaattgcaggaatggga |
53754574 |
T |
 |
| Q |
212 |
tccagcagagaaggaactcattcgaagatggtgtttcgggaacaacatgccccatcccaccagg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53754573 |
tccagcagagaaggaactcattcgaagatggtgtttcgggaacaacatgccccatcccaccagg |
53754510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 201 - 272
Target Start/End: Complemental strand, 8571972 - 8571901
Alignment:
| Q |
201 |
caggaatgggatccagcagagaaggaactcattcgaagatggtgtttcgggaacaacatgccccatcccacc |
272 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||| || | ||||||||||| ||||| ||||| |
|
|
| T |
8571972 |
caggaatggagtccagcagagaaggaactcatacgaagatggagtgtttggaacaacatgtcccattccacc |
8571901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University