View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_high_47 (Length: 268)
Name: NF20963_high_47
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 42098291 - 42098423
Alignment:
| Q |
1 |
tagaacttcagtttggtgaacaaaacacgcctttctaaatgcaaattattaaattcgaacgaagataaaatgatgattttgaaggacgtgtgaaaataaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42098291 |
tagaacttcagtttggtgaacaaaacatgcctttctaaatgcaaattattaaattcgaacgaagataaaatgatgattttgaaggacgtgtgaaaataaa |
42098390 |
T |
 |
| Q |
101 |
ttctgataaaatgaaagatagaagtagtaacta |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42098391 |
ttctgataaaatgaaagatagaagtagtaacta |
42098423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 133 - 251
Target Start/End: Original strand, 42098990 - 42099108
Alignment:
| Q |
133 |
agtaagaggaggtagtttaagtctcacccaacaagtacagctgtgttctagaaatgcccacgaccgccagaccccattccttattaattcactcattcat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42098990 |
agtaagaggaggtagtttaagtctcacccaacaagtacagctgtgttctagaaatgcccacgaccgccagaccccattccttattaattcactcattcat |
42099089 |
T |
 |
| Q |
233 |
tctctctcttatgctgatg |
251 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42099090 |
tctctctcttatgctgatg |
42099108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University