View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_high_54 (Length: 236)
Name: NF20963_high_54
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_high_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 38433738 - 38433944
Alignment:
| Q |
16 |
acaaacttagcttattgagtagttattgggcatctacttgcagttccaatgccacatcgtattgtatcagacatatctgtgtaatataatagaagcggtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38433738 |
acaaacttagcttattgagtagttattgggtatctacttgcagttccaatgccacatcgtattgtatcagacatatctgtgtaatataatagaagcggtt |
38433837 |
T |
|
| Q |
116 |
aagcttgtcctttataccccaatagaaaactaagacacaatttctaatagtcttgttacttggtcattggtcttgcttgacnnnnnnnnttggattaacc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38433838 |
aagcttgtcctttataccccaatagaaaactaagacacaatttctaatagtcttgttacttggtcattggtcttgcttgacaaaaaaaattggattaacc |
38433937 |
T |
|
| Q |
216 |
cacccat |
222 |
Q |
| |
|
||||||| |
|
|
| T |
38433938 |
cacccat |
38433944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University