View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20963_high_56 (Length: 211)

Name: NF20963_high_56
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20963_high_56
NF20963_high_56
[»] chr3 (1 HSPs)
chr3 (21-137)||(41584297-41584413)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 21 - 137
Target Start/End: Complemental strand, 41584413 - 41584297
Alignment:
21 tatcattcaaaatcaaaaccgtgattttcactctcttttcatttttcatggattattacacgatcctaactcactgagtcaaatctgaaaaactttccga 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
41584413 tatcattcaaaatcaaaaccgtgattttcactctcttttcatttttcatgtattattacacgatcctaactcactgagtcaaatctgaaaaactttccga 41584314  T
121 ttcacataaatatggcg 137  Q
    |||||||||||||||||    
41584313 ttcacataaatatggcg 41584297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University