View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20963_low_19 (Length: 417)

Name: NF20963_low_19
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20963_low_19
NF20963_low_19
[»] chr8 (1 HSPs)
chr8 (285-376)||(43554633-43554723)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 285 - 376
Target Start/End: Complemental strand, 43554723 - 43554633
Alignment:
285 ctacctcattgacttgtctaaatttaaattcaacatagtgttttcaaaatataaattagaacattgtttacattcagacaacagtggtggag 376  Q
    ||||||||||||||||||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
43554723 ctacctcattgacttgtctaagtttaaattcaacg-agtgttttcaaaatataaattagaacattgtttacattcagacaacagttgtggag 43554633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University