View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_low_19 (Length: 417)
Name: NF20963_low_19
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 285 - 376
Target Start/End: Complemental strand, 43554723 - 43554633
Alignment:
| Q |
285 |
ctacctcattgacttgtctaaatttaaattcaacatagtgttttcaaaatataaattagaacattgtttacattcagacaacagtggtggag |
376 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43554723 |
ctacctcattgacttgtctaagtttaaattcaacg-agtgttttcaaaatataaattagaacattgtttacattcagacaacagttgtggag |
43554633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University