View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20963_low_39 (Length: 325)

Name: NF20963_low_39
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20963_low_39
NF20963_low_39
[»] chr5 (1 HSPs)
chr5 (21-293)||(40518635-40518906)
[»] chr7 (1 HSPs)
chr7 (209-291)||(25983955-25984037)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 21 - 293
Target Start/End: Original strand, 40518635 - 40518906
Alignment:
21 gttagttgtgattcttctgttgatgatttggatcatgtgnnnnnnnactt-gtccttttgcaatgcaaggttggtttacaattggtttatagaacaacat 119  Q
    |||||||||||||||||||||||||||||||||||||||       |||| || ||||||||||||||||||||||||||||||||||||||||||||||    
40518635 gttagttgtgattcttctgttgatgatttggatcatgtgtttttttacttagttcttttgcaatgcaaggttggtttacaattggtttatagaacaacat 40518734  T
120 tcaacatattgtcaacaaaaccggtacgacctcataagtaatctttttgtagtcataacatctcacggccagactttgcaactcataccgttagtttgtt 219  Q
    ||||||||||||||||||||||||||||||||||||| |||| |||||||||| | ||| |||||| ||| |||||||||||||||| |||||||||| |    
40518735 tcaacatattgtcaacaaaaccggtacgacctcataattaatttttttgtagttagaacgtctcac-gccggactttgcaactcatatcgttagtttg-t 40518832  T
220 ttagattttatggaaggaccgcaatctcaaaatgtgggatgatgttacatagacggttgctcaaatagttgaca 293  Q
    || |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
40518833 ttggattttatggaaggaccgcaatctcaaagtgtgggatgatgttacatagacggttgctcaaatagttgaca 40518906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 209 - 291
Target Start/End: Original strand, 25983955 - 25984037
Alignment:
209 gttagtttgttttagattttatggaaggaccgcaatctcaaaatgtgggatgatgttacatagacggttgctcaaatagttga 291  Q
    ||||| ||||||| || |||||||||| ||| ||| |||||| |||| |||||||||||| ||||   ||||||| |||||||    
25983955 gttagcttgttttggagtttatggaagtaccacaacctcaaagtgtgagatgatgttacagagacaactgctcaagtagttga 25984037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University