View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_low_45 (Length: 279)
Name: NF20963_low_45
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 11 - 257
Target Start/End: Complemental strand, 55289928 - 55289677
Alignment:
| Q |
11 |
cagagaaacagcttggtttgtctcataattaataacactacaattat---agtcaccaaaggtacaaatacaaaatatcactcttttactgctgctgctg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55289928 |
cagagaaacagcttggtttgtctcataat-aataacactacaattattatagtcaccaaaggtacaaatacaaaatatcactcttttactgctgctgctg |
55289830 |
T |
 |
| Q |
108 |
---aaaccaattggctttgagagattgaatgtacaacattagaagacaggtaaaaaaggacaagcagataccgtcggcgagcacaacagtaaatacaata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55289829 |
cagaaaccaattggctttgagagattgaatgtacaacattagaagacaggtaaaaaaggacaagcagataccgtcggcgagcacaacagtaaatacaata |
55289730 |
T |
 |
| Q |
205 |
taattgcagtaaaaaccattctttccaattcaatagattgcaggacaggtcct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55289729 |
taattgcagtaaaaaccattctttccaattcaatagattgcaggacaggtcct |
55289677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University