View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_low_52 (Length: 258)
Name: NF20963_low_52
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 16433708 - 16433499
Alignment:
| Q |
17 |
atatttgtcgtggtggcttctgagccggactgcttttgctctgtggaagaagtccattccacttcgaagcttgttaggctttgttgtctgcatggttatg |
116 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16433708 |
atatttgtcgtggtggctgcgaagacggactgcttttgctctgtggaagaagtccattccgcttcgaagcttgttaggctttgttgtctgcatggttatg |
16433609 |
T |
 |
| Q |
117 |
agattcagctcttgtaacttcgattcgtaatacaaaaaatacagatgagaattttaatatggaataaagaggtttgtatattttttagttggtgagaggg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
16433608 |
agattcagctcttgtaacttcgattcgtaatacaaaaattacagatgagaattttaatatagaataaagaggttcgtatatttttttgttggtgagaggg |
16433509 |
T |
 |
| Q |
217 |
aaatgaaatg |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
16433508 |
aaatgaaatg |
16433499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University