View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_low_53 (Length: 243)
Name: NF20963_low_53
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 42467980 - 42468206
Alignment:
| Q |
13 |
cagcagaagtggcatatgattttttcaagttgccagtggaggagaaaatgaagttgtattcagacgatccaacaaagacaatgagactatctacaagttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42467980 |
cagcagaagtggcatatgattttttcaagttgccagtggaggagaaaatgaagttgtattcagacgatccaacaaagacaatgagactatctacaagttt |
42468079 |
T |
 |
| Q |
113 |
taatgtgaacaaagaggaggtgcataattggagggactaccttagacttcattgctatcctttggataattatgtgccagaatggccttctaatcctcct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42468080 |
taatgtgaacaaagaggaggtgcataattggagggactaccttagacttcattgctatcctttggataattatgtgccagaatggccttctaatcctcct |
42468179 |
T |
 |
| Q |
213 |
tcattcaagtaagtccactctcttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42468180 |
tcattcaagtaagtccactctcttcat |
42468206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University