View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_low_56 (Length: 238)
Name: NF20963_low_56
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 4 - 210
Target Start/End: Complemental strand, 42467824 - 42467618
Alignment:
| Q |
4 |
caatgtcacttaattaccaaaatgacattttattttatcactaagaattgaactgggttctctaaggttacaaatcatacacattgcgcatcaaccactt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42467824 |
caatgtcacttaattaccaaaatgacattttatttcatcattaagaattgaactaggttctctaaagttacaaatcatacacattgcgcatcaaccactt |
42467725 |
T |
|
| Q |
104 |
acgttagaactagtggcatcaggcttgcatgtgacaaatcaaattgtatttagcagaaataaggaattaatcctaattatgacgagtagcaaaagttatg |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42467724 |
acgttagaactagtggcatctggcttgcatgtgacaaatcaaattgtatttagcagaaatgaggaattaatcctaattatgacgagtagcaaaagttatg |
42467625 |
T |
|
| Q |
204 |
cttatct |
210 |
Q |
| |
|
||||||| |
|
|
| T |
42467624 |
cttatct |
42467618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University