View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_low_59 (Length: 211)
Name: NF20963_low_59
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 21 - 137
Target Start/End: Complemental strand, 41584413 - 41584297
Alignment:
| Q |
21 |
tatcattcaaaatcaaaaccgtgattttcactctcttttcatttttcatggattattacacgatcctaactcactgagtcaaatctgaaaaactttccga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41584413 |
tatcattcaaaatcaaaaccgtgattttcactctcttttcatttttcatgtattattacacgatcctaactcactgagtcaaatctgaaaaactttccga |
41584314 |
T |
 |
| Q |
121 |
ttcacataaatatggcg |
137 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41584313 |
ttcacataaatatggcg |
41584297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University