View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20963_low_60 (Length: 207)
Name: NF20963_low_60
Description: NF20963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20963_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 102 - 186
Target Start/End: Complemental strand, 31336161 - 31336077
Alignment:
| Q |
102 |
taatgccttcacataaaggtggcaggggggtcctaacagacaacgtccaaacaccatcaagtgttttcttcattttctgtcattc |
186 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31336161 |
taatgccttcatataaaggtggcaggtgggtcctaacagacaacgtccaaacaccatcaagcgttttcttcattttctgtcattc |
31336077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 84
Target Start/End: Complemental strand, 31336318 - 31336289
Alignment:
| Q |
55 |
tataaagatttcatttgtgcataatataga |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31336318 |
tataaagatttcatttgtgcataatataga |
31336289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University