View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20964_low_17 (Length: 292)
Name: NF20964_low_17
Description: NF20964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20964_low_17 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 111 - 292
Target Start/End: Complemental strand, 34694916 - 34694735
Alignment:
| Q |
111 |
gaattgggagaggaattgttttgaggtagtgatgtcacaaacgaaaaggacataataataagacgagatgaggtttgttctgaacaaaaacatacacttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34694916 |
gaattgggagaggaattgttttgaggtagtgatgtcccaaaccaaaaggacataataataagacgagatgaggtttgttctgaacaaaaacatacacttt |
34694817 |
T |
|
| Q |
211 |
gatcaaactaattagctttgccttgtgaaattttggaagtttataattgatatgaagatgcataggtaggtgaaacctcaac |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34694816 |
gatcaaactaattagctttgccttgtgaaattttggaagtttataattgatatgaagatgcataggtaggtgaaacctcaac |
34694735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 34825512 - 34825557
Alignment:
| Q |
99 |
gatgttagataggaattgggagaggaattgttttgaggtagtgatg |
144 |
Q |
| |
|
||||||||||| | ||||||||| |||||||||||||| ||||||| |
|
|
| T |
34825512 |
gatgttagataaggattgggagaagaattgttttgaggaagtgatg |
34825557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 11 - 68
Target Start/End: Original strand, 3903187 - 3903244
Alignment:
| Q |
11 |
agcaaaggtgattatgtttcagtaattgagatgatctttgttgcgttaaaggagatgg |
68 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3903187 |
agcaaaggtgattatgtttccgtaattgagatgatctttgttgcgttaaaggagatgg |
3903244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 11 - 68
Target Start/End: Complemental strand, 24719539 - 24719482
Alignment:
| Q |
11 |
agcaaaggtgattatgtttcagtaattgagatgatctttgttgcgttaaaggagatgg |
68 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24719539 |
agcaaaggtgattatgtttcggtaattgagatgatctttgttgcgttaaaggagatgg |
24719482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University