View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20964_low_24 (Length: 257)
Name: NF20964_low_24
Description: NF20964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20964_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 15591341 - 15591578
Alignment:
| Q |
1 |
catcagagag-ccagttgtatagaagagggcgttgatctctcaaactaaatgatacatcagtttctacaaggagagctgatgatgattctatgcaaaatc |
99 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
15591341 |
catcagagagtccagttgtagagaagagggcgttgatctctcaaactaaatgatacatcagtttctacaaggag--ctgatgatgattctacgcaaaatc |
15591438 |
T |
|
| Q |
100 |
ttagccagatcagcaactcctttgagaaaactttgggccttatccatcagctttaccaccttaccgtctccaccttgaacgttgtcttttaaatgtcact |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15591439 |
tgagccagatcagcaactcctttgagaaaacgttcggccttatccatcagctttaccaccttaccgtctccaccttgaacgttgtctttcaaatgtcact |
15591538 |
T |
|
| Q |
200 |
gca--ttttttataggtctttgtcttaacggtgatgatca |
237 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15591539 |
gcattttttttataggtctttgtcttaacggtgatgatca |
15591578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 80 - 151
Target Start/End: Complemental strand, 35445739 - 35445668
Alignment:
| Q |
80 |
tgatgattctatgcaaaatcttagccagatcagcaactcctttgagaaaactttgggccttatccatcagct |
151 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
35445739 |
tgatgattctatgcaaaaccttagccagatcagcaactccattgagaaaaccctgggcctcatccatcagct |
35445668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University