View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20965_high_9 (Length: 281)
Name: NF20965_high_9
Description: NF20965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20965_high_9 |
 |  |
|
| [»] chr1 (12 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 12)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 32253438 - 32253718
Alignment:
| Q |
1 |
ctggctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttgggtctcgctctctttcttcttgactatgttctcgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32253438 |
ctggctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttgggtcccgctctctttcttcttgactatgttctcgt |
32253537 |
T |
 |
| Q |
101 |
ctaagaaggtgtcttgatctcccttcatcttcttcctcctcgggacttctttcatattcttcatcttcttgctgccactcaggactgatgatgctgagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32253538 |
ctaagaaggtgtcttgatctcccttcatcttcttcctcctcgggacttctttcatattcttcatcttcttgctgccactcaggactgatgatgctgagac |
32253637 |
T |
 |
| Q |
201 |
cgccctctactctcacgatttggctcctctggtcgcgtggggattgtagtctcttagctgtatcctgatccgtgttgagag |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32253638 |
cgccctctactctcacgatttggctcctctggtcgcgtggggattgtagtctcttagctgtatcctgatccgtgttgagag |
32253718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 99 - 279
Target Start/End: Original strand, 32243012 - 32243192
Alignment:
| Q |
99 |
gtctaagaaggtgtcttgatctcccttcatcttcttcctcctcgggacttctttcatattcttcatcttcttgctgccactcaggactgatgatgctgag |
198 |
Q |
| |
|
||||| ||| |||||||| ||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32243012 |
gtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtattcttcatcttcttgctgccactcagggctgatgatgctgag |
32243111 |
T |
 |
| Q |
199 |
accgccctctactctcacgatttggctcctctggtcgcgtggggattgtagtctcttagctgtatcctgatccgtgttgag |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32243112 |
accgccctctactctcacgatttggctcctctggtcgcgtggagattgaagtctcttagctgtatcctgatccgtgttgag |
32243192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 99 - 279
Target Start/End: Original strand, 32248750 - 32248930
Alignment:
| Q |
99 |
gtctaagaaggtgtcttgatctcccttcatcttcttcctcctcgggacttctttcatattcttcatcttcttgctgccactcaggactgatgatgctgag |
198 |
Q |
| |
|
||||| ||| |||||||| ||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32248750 |
gtctacgaatgtgtcttggtctccgttcatcttcttcctcctcgtgacttctttcgtattcttcatcttcttgctgccactcagggctgatgatgctgag |
32248849 |
T |
 |
| Q |
199 |
accgccctctactctcacgatttggctcctctggtcgcgtggggattgtagtctcttagctgtatcctgatccgtgttgag |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32248850 |
accgccctctactctcacgatttggctcctctggtcgcgtggagattgaagtctcttagctgtatcctgatccgtgttgag |
32248930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 32242866 - 32242959
Alignment:
| Q |
1 |
ctggctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttgggtctcgctctctttcttcttgactatgt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||| || |||||| |
|
|
| T |
32242866 |
ctggctatgtccgggatgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgt |
32242959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 32248604 - 32248697
Alignment:
| Q |
1 |
ctggctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttgggtctcgctctctttcttcttgactatgt |
94 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||| || |||||| |
|
|
| T |
32248604 |
ctggccatgtccgggacgtcttggatcccattctctttctttctgactatgtccgggacgtcttgggtctcgttctctttcttcctggctatgt |
32248697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 32 - 94
Target Start/End: Original strand, 32242813 - 32242875
Alignment:
| Q |
32 |
tctctttcttcctgactatgtccgggatgtcttgggtctcgctctctttcttcttgactatgt |
94 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |||||| |
|
|
| T |
32242813 |
tctctttcttcctgactatgtccgggacgtcttgggtctcgctctctttcttcctggctatgt |
32242875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 32 - 94
Target Start/End: Original strand, 32253385 - 32253447
Alignment:
| Q |
32 |
tctctttcttcctgactatgtccgggatgtcttgggtctcgctctctttcttcttgactatgt |
94 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
32253385 |
tctctttcttcctgactatgtctgggatgtcttgggtctcgctctctttcttcctggctatgt |
32253447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 5 - 94
Target Start/End: Original strand, 32253400 - 32253489
Alignment:
| Q |
5 |
ctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttgggtctcgctctctttcttcttgactatgt |
94 |
Q |
| |
|
||||||| |||||||||||| || | |||||||||||||| |||||||||||||||||||| || | ||||||||||| ||||||||| |
|
|
| T |
32253400 |
ctatgtctgggatgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccattctctttcttcctgactatgt |
32253489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 5 - 94
Target Start/End: Original strand, 32242828 - 32242917
Alignment:
| Q |
5 |
ctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttgggtctcgctctctttcttcttgactatgt |
94 |
Q |
| |
|
|||||||||||| ||||||| || | |||||||||||||| |||||||||||||||||||| || | |||||||||| ||||||||| |
|
|
| T |
32242828 |
ctatgtccgggacgtcttgggtctcgctctctttcttcctggctatgtccgggatgtcttggatcccattctctttctttctgactatgt |
32242917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 32242912 - 32242972
Alignment:
| Q |
5 |
ctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttg |
65 |
Q |
| |
|
|||||||||||| ||||||| || | ||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
32242912 |
ctatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatcttg |
32242972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 32248650 - 32248710
Alignment:
| Q |
5 |
ctatgtccgggatgtcttggatcccattctctttcttcctgactatgtccgggatgtcttg |
65 |
Q |
| |
|
|||||||||||| ||||||| || | ||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
32248650 |
ctatgtccgggacgtcttgggtctcgttctctttcttcctggctatgtctgggatatcttg |
32248710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 94
Target Start/End: Original strand, 32248578 - 32248655
Alignment:
| Q |
17 |
tgtcttggatcccattctctttcttcctgactatgtccgggatgtcttgggtctcgctctctttcttcttgactatgt |
94 |
Q |
| |
|
|||||||| || | ||||||||||||||| | |||||||||| ||||||| || | |||||||||| ||||||||| |
|
|
| T |
32248578 |
tgtcttgggtctcgttctctttcttcctggccatgtccgggacgtcttggatcccattctctttctttctgactatgt |
32248655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University