View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20965_low_18 (Length: 239)
Name: NF20965_low_18
Description: NF20965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20965_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 19197444 - 19197663
Alignment:
| Q |
1 |
ttctcccaagatttcttctttccccgttcaagttcactctgcaannnnnnncggctttcctcagccttttctatctctccgtctgcaactagatttacat |
100 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
19197444 |
ttctccgaagatttcttacttccccgttcaagttcactctgcaatttttttcggctttcctcagccttggctatcgctccgtctgcaactagatttacat |
19197543 |
T |
|
| Q |
101 |
acttctccaaagatttcttccttcccctttcaagttctttctgcaatttagaagtttgcaattagtttttaaattaaagttcaacttttcatctcccact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19197544 |
acttctccaaagatttcttccttcccctttcaagttcactctgcaatttagaagtttgcaattagtttttaaattaaagttcaacttttcatctcccacc |
19197643 |
T |
|
| Q |
201 |
acattttttacccggcctct |
220 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
19197644 |
acattttttacccagcctct |
19197663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 19201478 - 19201531
Alignment:
| Q |
52 |
cggctttcctcagccttttctatctctccgtctgcaactagatttacatacttc |
105 |
Q |
| |
|
||||||||||||||||| || || | ||||||||||||||||||||||||||| |
|
|
| T |
19201478 |
cggctttcctcagccttggctctcgcgccgtctgcaactagatttacatacttc |
19201531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University