View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20965_low_19 (Length: 237)
Name: NF20965_low_19
Description: NF20965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20965_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 6 - 220
Target Start/End: Original strand, 7808298 - 7808510
Alignment:
| Q |
6 |
ggagaagcaaaggcaattccaagtttattttaaaggcagctagtagatgggaaattgatgatgctacttgtataccaatttggaataatcgttggatcaa |
105 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| ||||||||||||| |||||| |||||| |||| ||||||||||||||||||| ||||||| || |
|
|
| T |
7808298 |
ggagaagcatatgcaattccaagtttattttaaaggaagctagtagatggaaaattggtgatgc-acttctataccaatttggaataattgttggatgaa |
7808396 |
T |
|
| Q |
106 |
agaaaatgttactcttttccctcttcaggatgttgtttccacattggcaaatatgttactcttcagattgtatatacattacatggatcataaggcttgg |
205 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7808397 |
agaaaatgttactcttttcccacttcaggatgttgtttccacattggcaaatatgcgtgt-atcagattgtatatacattacatggatcataaggcttgg |
7808495 |
T |
|
| Q |
206 |
aatgttcttttcttg |
220 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
7808496 |
aatgttcctttcttg |
7808510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University