View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20965_low_9 (Length: 300)
Name: NF20965_low_9
Description: NF20965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20965_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 17 - 290
Target Start/End: Complemental strand, 42272580 - 42272307
Alignment:
| Q |
17 |
cacttaagtcagtgaaggttttaggaatcaagaggttattcaaagactaacttttgtacctttttataggagaatgacttctaaattaggtggttggagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42272580 |
cacttaagtcagtgaaggttttaggaattaagaggttattcaaagactaacttttgtacctttttataggagaatgacttctagattaggtggttggagt |
42272481 |
T |
|
| Q |
117 |
caccacatggacgtgaggccgttaggcggttgtgctttacataacgcctcattcggaccaccgctcaattgatatggaagggttaaaaatagttttgggc |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272480 |
cgccacatggacgtgaggccgttaggcggttgtgctttacataacgcctcattcggaccaccgctcaattgatatggaagggttaaaaatagttttgggc |
42272381 |
T |
|
| Q |
217 |
tcttttttcctacttagaggctctatggtgacccatatttgaatcaaacacgtcgtcaggcctttatccctttg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42272380 |
tcttttttcctacttagaggctctatggtgacccatatttgaatcaaacacgtcgtcatgcctttatccctttg |
42272307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University