View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20966_high_25 (Length: 280)
Name: NF20966_high_25
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20966_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 30502357 - 30502264
Alignment:
| Q |
19 |
agtgcggtagcgagggagatagatatcaacatcgacaaaccagggttctagatcgaaagaccggctagtccagatttgttaggagtgaatcatca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30502357 |
agtgcggtagcgagggagatagatatcaacatcgacaaaccagggttttagatcgaaagaccggctagt-cagatttgttaggagtgaatcatca |
30502264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 119 - 215
Target Start/End: Complemental strand, 30502124 - 30502025
Alignment:
| Q |
119 |
tttatggttttcagtttaagacttaaaaatttaannnnnnnn---ctggttggtagtaatgaaggaaattaccgatcgattaaaatagtttctgaaaaag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| || |||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
30502124 |
tttatggtttttagtttaagacttaaaaatttaatttttttttttctggtcggcagtaatgaaggaaattactaattgattaaaacagtttctgaaaaag |
30502025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University